[ARVADOS] created: f9055902efd4932522f39ca9eb37b54d2b75f8e1

Wed May 13 17:56:56 EDT 2015

at  f9055902efd4932522f39ca9eb37b54d2b75f8e1 (commit)


commit f9055902efd4932522f39ca9eb37b54d2b75f8e1
Author: Nancy Ouyang <nancy.ouyang at gmail.com>
Date:   Wed May 13 17:56:53 2015 -0400

    refs 5390: misc. small documentation fixes

diff --git a/doc/_includes/_tutorial_cluster_name.liquid b/doc/_includes/_tutorial_cluster_name.liquid
new file mode 100644
index 0000000..cdfb5ee
--- /dev/null
+++ b/doc/_includes/_tutorial_cluster_name.liquid
@@ -0,0 +1,3 @@
+{% include 'notebox_begin' %}
+This tutorial assumes you are using the default Arvados instance, @qr1hi at . If you are using a different instance, replace @qr1hi@ with your instance, for instance @su12l at . See "Accessing Arvados Workbench":{{site.baseurl}}/user/getting_started/workbench.html for more details.
+{% include 'notebox_end' %}
diff --git a/doc/user/topics/arv-run.html.textile.liquid b/doc/user/topics/arv-run.html.textile.liquid
index 862b19c..9eabfac 100644
--- a/doc/user/topics/arv-run.html.textile.liquid
+++ b/doc/user/topics/arv-run.html.textile.liquid
@@ -43,6 +43,8 @@ h2. Parallel tasks
 
 <notextile>
 <pre>
+$ <span class="userinput">cd ~/keep/by_id/3229739b505d2b878b62aed09895a55a+142</span>
+$ <span class="userinput">ls *.fastq</span>
 HWI-ST1027_129_D0THKACXX.1_1.fastq  HWI-ST1027_129_D0THKACXX.1_2.fastq
 $ <span class="userinput">arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC -- *.fastq</span>
 Running pipeline qr1hi-d1hrv-mg3bju0u7r6w241
@@ -75,6 +77,8 @@ You may use "run-command":run-command.html parameter substitution in the output
 
 <notextile>
 <pre>
+$ <span class="userinput">cd ~/keep/by_id/3229739b505d2b878b62aed09895a55a+142</span>
+$ <span class="userinput">ls *.fastq</span>
 $ <span class="userinput">arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC \< *.fastq \> '$(task.uuid).txt'</span>
 [...]
  1 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC < /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq > qr1hi-ot0gb-hmmxf2zubfpmhfk.txt
@@ -99,6 +103,8 @@ Multiple commands may be connected by pipes and execute in the same container:
 
 <notextile>
 <pre>
+$ <span class="userinput">cd ~/keep/by_id/3229739b505d2b878b62aed09895a55a+142</span>
+$ <span class="userinput">ls *.fastq</span>
 $ <span class="userinput">arv-run cat -- *.fastq \| grep -H -n ATTGGAGGAAAGATGAGTGAC \> output.txt</span>
 [...]
  1 stderr run-command: cat /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq | grep -H -n ATTGGAGGAAAGATGAGTGAC > output.txt
diff --git a/doc/user/topics/running-pipeline-command-line.html.textile.liquid b/doc/user/topics/running-pipeline-command-line.html.textile.liquid
index 147fbf0..ac67981 100644
--- a/doc/user/topics/running-pipeline-command-line.html.textile.liquid
+++ b/doc/user/topics/running-pipeline-command-line.html.textile.liquid
@@ -32,9 +32,11 @@ bwa-mem qr1hi-8i9sb-67n1qvsronmd2z6 49bae1066f4ebce72e2587a3efa61c7d+88
 
 This instantiates your pipeline and displays periodic status reports in your terminal window. The new pipeline instance will also show up on the Workbench Dashboard.
 
+{% include 'tutorial_cluster_name' %}
+
 @arv pipeline run@ submits a job for each pipeline component as soon as the component's inputs are known (i.e., any dependencies are satsified). It terminates when there is no work left to do: this means either all components are satisfied and all jobs have completed successfully, _or_ one or more jobs have failed and it is therefore unproductive to submit any further jobs.
 
-The Keep locators of the output of of the @bwa-mem@ components are available from the last status report shown above:
+The Keep locators of the output of the @bwa-mem@ components are available from the last status report shown above:
 
 <notextile>
 <pre><code>~$ <span class="userinput">arv keep ls -s 49bae1066f4ebce72e2587a3efa61c7d+88</span>
diff --git a/doc/user/tutorials/tutorial-keep.html.textile.liquid b/doc/user/tutorials/tutorial-keep.html.textile.liquid
index 0d8dfb3..4de744a 100644
--- a/doc/user/tutorials/tutorial-keep.html.textile.liquid
+++ b/doc/user/tutorials/tutorial-keep.html.textile.liquid
@@ -4,7 +4,7 @@ navsection: userguide
 title: "Uploading data"
 ...
 
-Arvados Data collections can be uploaded using either the @*arv keep put*@ command line tool or using Workbench.
+Arvados Data collections can be uploaded using either the @arv keep put@ command line tool or using Workbench.
 
 # "*Upload using command line tool*":#upload-using-command
 # "*Upload using Workbench*":#upload-using-workbench
@@ -24,9 +24,10 @@ qr1hi-4zz18-xxxxxxxxxxxxxxx
 </code></pre>
 </notextile>
 
+
 The output value @qr1hi-4zz18-xxxxxxxxxxxxxxx@ is the uuid of the Arvados collection created.
 
-The file used in this example is a freely available TSV file containing variant annotations from "Personal Genome Project (PGP)":http://www.pgp-hms.org participant "hu599905.":https://my.pgp-hms.org/profile/hu599905), downloadable "here":https://warehouse.pgp-hms.org/warehouse/f815ec01d5d2f11cb12874ab2ed50daa+234+K@ant/var-GS000016015-ASM.tsv.bz2.
+Note: The file used in this example is a freely available TSV file containing variant annotations from "Personal Genome Project (PGP)":http://www.pgp-hms.org participant "hu599905":https://my.pgp-hms.org/profile/hu599905), downloadable "here":https://warehouse.pgp-hms.org/warehouse/f815ec01d5d2f11cb12874ab2ed50daa+234+K@ant/var-GS000016015-ASM.tsv.bz2. Alternatively, you can replace @var-GS000016015-ASM.tsv.bz2@ with the name of any file you have locally, or you could get the TSV file by "downloading it from Keep.":{{site.baseurl}}/user/tutorials/tutorial-keep-get.html
 
 <notextile><a name="dir"></a></notextile>It is also possible to upload an entire directory with @arv keep put@:
 

-----------------------------------------------------------------------


hooks/post-receive
-- 


