[ARVADOS] updated: 7ca020894d276edf9098132f4757cdd46b6b1441

Tue Jun 2 20:08:19 EDT 2015

Summary of changes:
 doc/_includes/_arv_run_redirection.liquid                         | 2 ++
 doc/_includes/_tutorial_cluster_name.liquid                       | 2 +-
 doc/user/topics/running-pipeline-command-line.html.textile.liquid | 2 +-
 doc/user/tutorials/tutorial-keep.html.textile.liquid              | 2 +-
 4 files changed, 5 insertions(+), 3 deletions(-)

       via  7ca020894d276edf9098132f4757cdd46b6b1441 (commit)
      from  6b0931644aa30ad9d271ea06c8fa413696c562c0 (commit)

Those revisions listed above that are new to this repository have
not appeared on any other notification email; so we list those
revisions in full, below.


commit 7ca020894d276edf9098132f4757cdd46b6b1441
Author: Nancy Ouyang <nancy.ouyang at gmail.com>
Date:   Tue Jun 2 20:08:16 2015 -0400

    5930: fixed as per code review

diff --git a/doc/_includes/_arv_run_redirection.liquid b/doc/_includes/_arv_run_redirection.liquid
index aa63366..c63c2d9 100644
--- a/doc/_includes/_arv_run_redirection.liquid
+++ b/doc/_includes/_arv_run_redirection.liquid
@@ -1,5 +1,7 @@
 <notextile>
 <pre>
+$ <span class="userinput">cd ~/keep/by_id/3229739b505d2b878b62aed09895a55a+142</span>
+$ <span class="userinput">ls *.fastq</span>
 $ <span class="userinput">arv-run grep -H -n ATTGGAGGAAAGATGAGTGAC \< *.fastq \> output.txt</span>
 [...]
  1 stderr run-command: grep -H -n ATTGGAGGAAAGATGAGTGAC < /keep/3229739b505d2b878b62aed09895a55a+142/HWI-ST1027_129_D0THKACXX.1_1.fastq > output.txt
diff --git a/doc/_includes/_tutorial_cluster_name.liquid b/doc/_includes/_tutorial_cluster_name.liquid
index cdfb5ee..febd240 100644
--- a/doc/_includes/_tutorial_cluster_name.liquid
+++ b/doc/_includes/_tutorial_cluster_name.liquid
@@ -1,3 +1,3 @@
 {% include 'notebox_begin' %}
-This tutorial assumes you are using the default Arvados instance, @qr1hi at . If you are using a different instance, replace @qr1hi@ with your instance, for instance @su12l at . See "Accessing Arvados Workbench":{{site.baseurl}}/user/getting_started/workbench.html for more details.
+This tutorial assumes you are using the default Arvados instance, @qr1hi at . If you are using a different instance, replace @qr1hi@ with your instance. See "Accessing Arvados Workbench":{{site.baseurl}}/user/getting_started/workbench.html for more details.
 {% include 'notebox_end' %}
diff --git a/doc/user/topics/running-pipeline-command-line.html.textile.liquid b/doc/user/topics/running-pipeline-command-line.html.textile.liquid
index ac67981..8c27fbf 100644
--- a/doc/user/topics/running-pipeline-command-line.html.textile.liquid
+++ b/doc/user/topics/running-pipeline-command-line.html.textile.liquid
@@ -7,6 +7,7 @@ title: "Running a pipeline on the command line"
 This tutorial demonstrates how to use the command line to run the same pipeline as described in "running a pipeline using Workbench.":{{site.baseurl}}/user/tutorials/tutorial-pipeline-workbench.html
 
 {% include 'tutorial_expectations' %}
+{% include 'tutorial_cluster_name' %}
 
 When you use the command line, you must use Arvados unique identifiers to refer to objects.  The identifiers in this example correspond to the following Arvados objects:
 
@@ -32,7 +33,6 @@ bwa-mem qr1hi-8i9sb-67n1qvsronmd2z6 49bae1066f4ebce72e2587a3efa61c7d+88
 
 This instantiates your pipeline and displays periodic status reports in your terminal window. The new pipeline instance will also show up on the Workbench Dashboard.
 
-{% include 'tutorial_cluster_name' %}
 
 @arv pipeline run@ submits a job for each pipeline component as soon as the component's inputs are known (i.e., any dependencies are satsified). It terminates when there is no work left to do: this means either all components are satisfied and all jobs have completed successfully, _or_ one or more jobs have failed and it is therefore unproductive to submit any further jobs.
 
diff --git a/doc/user/tutorials/tutorial-keep.html.textile.liquid b/doc/user/tutorials/tutorial-keep.html.textile.liquid
index 4de744a..c7903c6 100644
--- a/doc/user/tutorials/tutorial-keep.html.textile.liquid
+++ b/doc/user/tutorials/tutorial-keep.html.textile.liquid
@@ -27,7 +27,7 @@ qr1hi-4zz18-xxxxxxxxxxxxxxx
 
 The output value @qr1hi-4zz18-xxxxxxxxxxxxxxx@ is the uuid of the Arvados collection created.
 
-Note: The file used in this example is a freely available TSV file containing variant annotations from "Personal Genome Project (PGP)":http://www.pgp-hms.org participant "hu599905":https://my.pgp-hms.org/profile/hu599905), downloadable "here":https://warehouse.pgp-hms.org/warehouse/f815ec01d5d2f11cb12874ab2ed50daa+234+K@ant/var-GS000016015-ASM.tsv.bz2. Alternatively, you can replace @var-GS000016015-ASM.tsv.bz2@ with the name of any file you have locally, or you could get the TSV file by "downloading it from Keep.":{{site.baseurl}}/user/tutorials/tutorial-keep-get.html
+Note: The file used in this example is a freely available TSV file containing variant annotations from the "Personal Genome Project (PGP)":http://www.pgp-hms.org participant "hu599905":https://my.pgp-hms.org/profile/hu599905), downloadable "here":https://warehouse.pgp-hms.org/warehouse/f815ec01d5d2f11cb12874ab2ed50daa+234+K@ant/var-GS000016015-ASM.tsv.bz2. Alternatively, you can replace @var-GS000016015-ASM.tsv.bz2@ with the name of any file you have locally, or you could get the TSV file by "downloading it from Keep.":{{site.baseurl}}/user/tutorials/tutorial-keep-get.html
 
 <notextile><a name="dir"></a></notextile>It is also possible to upload an entire directory with @arv keep put@:
 

-----------------------------------------------------------------------


hooks/post-receive
-- 


